Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=63 nt.     Delta G=-23.40 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=59 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaaaatactttcaagagttaatatgagtatgtaattcaaacgaaaagtgaatattatgccgtcgtataatatcggggatatggcccgaaagtttc
tacctagctaccgtaaatggcttgactacgaggcgtttttataaaggtgaggggaatcttatctttattcatagaacgcttccatgtatatgcaatggaa
gccttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG

    BAS0255


Gene: BAS0255     GI: 49183287     BI number: BAS0255     GOG: COG2252     Description: xanthine/uracil permease family protei


           ga
          g  a
 ct        gt
a  a       gc
 gc        at
 tg        gt
 ta        ta
 cg        gt
g  g       gc
 gc        at
 tg        at
 at        at
 at        ta
 at        at
|  t      |  t
|  t      |  c
t  a      |  a
g  t      t  t
c  a       ta
c  a       tg
a  a       ta        ta
 tg        ta       a  t
 cg        gc        tg
 gt        cg        gc
a  g       gc       |  a
 ta        gt        ta
 cg        at        at
 cg        gc        cg
a  |      c  c       cg
 tg       a  a       ta
 cg       t  t       ta
 ta        cg        cg
 ta        at        gc
                        cttttttatttttaataaataaaagagggctaggggaattacggcgagtaatcatataacgggggaaacgtaagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2252 Permeases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Guanine_G-box sequence ... can be seen here

    ..................................................................................................................