Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGGT-TACAAT. It has a score value of 60.91 and is shown in blue

TTGGGTTTATCTTCTATCCAATTACAATGGTAGTAAGTGGTCGACGTAAAGAGATTCA
TCCAATTATGTATGTTATGGGAGTTTTATTCGTACTATATTTCATTTATGTTCGTAAA
TAAaaggggtttttgaaaggtctagacttaaggggagtctagaccttttttgcgtcttcagaaaaacttaaggatttccgagcgtttttcttcagaag
ttttcctataatagaagttagggattaaaaaagtaatgggggagatattGTG

    BAS0256 --- BAS0257


Gene: BAS0256     GI: 49183288     BI number: BAS0256     GOG: COG0745     Description: DNA-binding response regulator
Gene: BAS0257     GI: 49183289     BI number: BAS0257     GOG: COG0642     Description: sensor histidine kinas


           g
         a  g
         a  g
          tg
          ta
          cg
          at
          gc
          at
          ta
          cg
          ta
          gc
          gc
          at
            tttttgcgtcttcagaaaaacttaaggatttccgagcgtttttcttcagaagttttcctataatagaagttagggattaaaaaagtaatgggggagatattGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here
[T] COG0642 Signal transduction histidine kinase ... can be seen here

    ..................................................................................................................