                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGTATGGTGCGTGAAGAAGCTTACGATATCGTACAACCTAAAGCGATGGAAGCTTG
GGAAACACAAGTACAATTTAAAGAGCTTGTAGAAGCTGATGAGCGTATTACGAGCAAG
TTAACACAAGAAGAAATTAATGAATGCTTTAACTATGAGCATCATATGCAACACGTTG
ATACAATCTTTGAACGCCTAGGATTAAACGAAGCGTAAaatttcatatggcacagaatagagtcattctgtg
ccattctttataaaaacattattcacatttttcaaactacagggggcttgcgaaATG

    BAS0278 --- BAS0279 --- BAS0280 --- BAS0281 --- BAS0282 Gene: BAS0278     GI: 49183306     BI number: BAS0278     GOG: COG0152     Description: phosphoribosylaminoimidazole-succinocarboxamide synthase Gene: BAS0279     GI: 49183307     BI number: BAS0279     GOG: COG1828     Description: phosphoribosylformylglycinamidine synthase, PurS protein Gene: BAS0280     GI: 49183308     BI number: BAS0280     GOG: COG0047     Description: phosphoribosylformylglycinamidine synthase I Gene: BAS0281     GI: 49183309     BI number: BAS0281     GOG: COG0046     Description: phosphoribosylformylglycinamidine synthase II Gene: BAS0282     GI: 49183310     BI number: BAS0282     GOG: COG0034     Description: amidophosphoribosyltransferas             C   C       A  G G  A      A  C A  T      G  C GC       T  T TA        TA AT        TG TA        CG C  T       TA A  |       AT A  |       AT T  |      |  A T  |      C  A T  |      A  A CG       T  C GC       A  G TA       G  A |  A       TA A  C       TG A  A       GC GC        CG TG        AT AT       |  A       ag AT       |  A      g  t TG       |  a      a  c TA       C  a       ta AT       A  t       at |  A      A  t       at |  C      C  t       gc |  A       Gc        at A  A       Ta        cg AT        At        at GC        Ta        cg AT        At        gc AT        Cg        gc GT        Tg        ta                         ttctttataaaaacattattcacatttttcaaactacagggggcttgcgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0152 Phosphoribosylaminoimidazolesuccinocarboxamide (SAICAR) synthase ... can be seen here [F] COG1828 Phosphoribosylformylglycinamidine (FGAM) synthase, PurS component ... can be seen here [F] COG0047 Phosphoribosylformylglycinamidine (FGAM) synthase, glutamine amidotransferase domain ... can be seen here [F] COG0046 Phosphoribosylformylglycinamidine (FGAM) synthase, synthetase domain ... can be seen here [F] COG0034 Glutamine phosphoribosylpyrophosphate amidotransferase ... can be seen here     ..................................................................................................................