                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:156 nt.    Distance to gene:50 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-13.70 kcal/mol
Antiterminator:    Distance from promoter:119 nt. Size=42 nt.     Delta G= -4.07 kcal/mol
Anti-antiterminator:    Distance from promoter:97 nt.    Size=27 nt.     Delta G= -5.82 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAAA-TAACAT. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAATGATCGGTGCAGACTCATTAACATTTTTAAGTGAAGATGGATTAGTAGATGC
AATTGGACGTCCATATGAAGGGAAATATGGCGGCCTATGTATGGCTTACTTTAATGGG
GACTATCCAACAGCTCTTTATGATTATGAGCAAGAGCTTTTAGAAAGTATGAAATAAg
aaaaatgaaaaaagcttctacttcttttgatgtagaagctagcttcttttttataaatagcccgccctggatggggagaaattaaaagacgaggtgtaaa
taacgATG

    BAS0283 --- BAS0284 --- BAS0285 Gene: BAS0283     GI: 49183311     BI number: BAS0283     GOG: COG0150     Description: phosphoribosylformylglycinamidine cyclo-ligase Gene: BAS0284     GI: 49183312     BI number: BAS0284     GOG: COG0299     Description: phosphoribosylglycinamide formyltransferase Gene: BAS0285     GI: 49183313     BI number: BAS0285     GOG: COG0138     Description: phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolas            AT           A  A           A  A           G  g           T  a           A  a           T  a   T       G  a       tt T  A      A  a      t  t A  T      A  t       cg G  G      A  g       ta T  A      G  a      t  t A  G      A  a       cg T  C       Ta        at TA        Ta        ta TA        Ta        cg CG        Ta        ta TA        Cg        ta CG        Gc        cg GC        At        gc AT        Gt        at                         agcttcttttttataaatagcccgccctggatggggagaaattaaaagacgaggtgtaaataacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0150 Phosphoribosylaminoimidazole (AIR) synthetase ... can be seen here [F] COG0299 Folate-dependent phosphoribosylglycinamide formyltransferase PurN ... can be seen here [F] COG0138 AICAR transformylase/IMP cyclohydrolase PurH (only IMP cyclohydrolase domain in Aful) ... can be seen here     ..................................................................................................................