                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -6.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACAAACCACAGTCAAATGGAAGTTATGACGCTTCTGACAAAGAGATTGAGTCAGCG
ATTGAAGATATAATCCTGGCAAAACCGCTTTGAatcatttgtcacgatgcaagatgctctcaaagagacttagctg
ctgcagtgggcggttaagtcttctttattttaccataaaacagaacatacattcttattttaagtgttaaaatatacataatcaataaaattcagaaaac
tagatgtaaaccccttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG

    BAS0288 --- BAS0287 Gene: BAS0288     GI: 49183316     BI number: BAS0288     GOG: COG0330     Description: SPFH domain/band 7 family protein Gene: BAS0287     GI: 49183315     BI number: BAS0287     GOG: COG4877     Description: conserved domain protei TT T  G C  A G  a C  t C  c A  a At At At Cg         a        ag Gt       a  a      c  t Gc        cg       g  g Ta        ta        tg C  c       cg        cg Cg        ta        gc Ta       |  c       tg At       |  t       cg |  g      |  t       gt |  c      |  a       at |  a       cg        ta |  a       gc        ta A  g      t  t       cg Ta       a  g       at At       g  c       gc Tg       a  |      |  t |  c       at        at At        cg        gc Gc        gc        at At        ta        at                         tattttaccataaaacagaacatacattcttattttaagtgttaaaatatacataatcaataaaattcagaaaactagatgtaaaccccttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0330 Membrane protease subunits, stomatin/prohibitin homologs ... can be seen here [S] COG4877 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................