Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -6.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACAAACCACAGTCAAATGGAAGTTATGACGCTTCTGACAAAGAGATTGAGTCAGCG
ATTGAAGATATAATCCTGGCAAAACCGCTTTGAatcatttgtcacgatgcaagatgctctcaaagagacttagctg
ctgcagtgggcggttaagtcttctttattttaccataaaacagaacatacattcttattttaagtgttaaaatatacataatcaataaaattcagaaaac
tagatgtaaaccccttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG

    BAS0288 --- BAS0287


Gene: BAS0288     GI: 49183316     BI number: BAS0288     GOG: COG0330     Description: SPFH domain/band 7 family protein
Gene: BAS0287     GI: 49183315     BI number: BAS0287     GOG: COG4877     Description: conserved domain protei


 TT
T  G
C  A
G  a
C  t
C  c
A  a
 At
 At
 At
 Cg         a        ag
 Gt       a  a      c  t
 Gc        cg       g  g
 Ta        ta        tg
C  c       cg        cg
 Cg        ta        gc
 Ta       |  c       tg
 At       |  t       cg
|  g      |  t       gt
|  c      |  a       at
|  a       cg        ta
|  a       gc        ta
A  g      t  t       cg
 Ta       a  g       at
 At       g  c       gc
 Tg       a  |      |  t
|  c       at        at
 At        cg        gc
 Gc        gc        at
 At        ta        at
                        tattttaccataaaacagaacatacattcttattttaagtgttaaaatatacataatcaataaaattcagaaaactagatgtaaaccccttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0330 Membrane protease subunits, stomatin/prohibitin homologs ... can be seen here
[S] COG4877 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................