                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATCCATTCGGTCACGTAGATGATAAAGTCGTTGCAGAAACGAAAAAATATTATCAA
TTCGCAACAACAACAAAACCTGGAAAATTCATTACAAAAGGTGAACCCGATGAGTTGT
TAAAAATGAAGCGTGTTCGCATACACCATACGACGACCGTAGAACAATTTGCTTCTTC
GATTAAATAAcgatgagagctcaatatattttgagctctctttttatgctatatttatatatattttttgaattttcttgtattatatatagt
aagaaatctttcaaattaaaggagattatacatATG

    BAS0314 Gene: BAS0314     GI: 49183342     BI number: BAS0314     GOG: COG2309     Description: aminopeptidase Amp   G C  A A  C GC CG AT TA A  | C  | C  | A  | C  | A  | T  | A  | C  | G  |        A CG       A  A TA       T  T       ta TA       T  A      a  t GC       A  A      t  t TA        Gc        at |  A       Cg        at |  T       Ta        cg |  T      T  t       ta GT        Cg        cg CG        Ta        gc GC       |  g       at AT        Ta        gc AT        Cg        at GC        Gc        gc                         tttttatgctatatttatatatattttttgaattttcttgtattatatatagtaagaaatctttcaaattaaaggagattatacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2309 Leucyl aminopeptidase (aminopeptidase T) ... can be seen here     ..................................................................................................................