Gene putatively regulated by attenuation in B_anthracis_str_Sterne
Characteristics of the secondary structures
Terminator: Distance from promoter:160 nt. Distance to gene:39 nt. Distance to run of Ts=0 nt. Size=26 nt. Delta G=-15.30 kcal/mol
Antiterminator: Distance from promoter:125 nt. Size=43 nt. Delta G= -6.10 kcal/mol
Anti-antiterminator: Distance from promoter:87 nt. Size=52 nt. Delta G= -5.55 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgaaagttagaggggatggattttattcatttatggggagttgttttatttagttttgagatcttttttagacaataactgaaaagggaatttcttaag
aatgaataaagctatcagtatctttttgttgtaacatatactttgtatatgtggagtgtttggtttgattaaatttagtttaaaatgaggcaactttcct
tttggagagttgtcttttatgctttacagtaaatatataggcaagtaattagagtgaATG

BAS0320
Gene: BAS0320 GI: 49183348 BI number: BAS0320 GOG: ------- Description: hypothetical protei
t
t t
cg
at
ta
at at
ta a t
at at
cg ta
at tg
a g at
t g gt
g a | t
t g | a
t t ta
g g ta tt
t t ta t t
t t gt cg
t t g g cg
t | ta ta
t | tg tg
cg tg ta
tg gc cg
at | a at
t | ta at
gt gc cg
at at gt
cg gt gc
ttttatgctttacagtaaatatataggcaagtaattagagtgaATG
..................................................................................................................