Gene putatively regulated by attenuation in B_anthracis_str_Sterne
Characteristics of the secondary structures
Terminator: Distance to gene:86 nt. Distance to run of Ts=3 nt. Size=31 nt. Delta G=-10.00 kcal/mol
Antiterminator: Size=37 nt. Delta G= -3.30 kcal/mol
Anti-antiterminator: Size=42 nt. Delta G= -5.50 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
AATTAGTGGAAGAAATATTGAACGAACCAATTCCGGAAGATATGGATGTTAAAGATGA
AGATTAActatgggaaatcccttatgaagatatgcagaaatgtatcttcataagggatttttttgtttaaagatatcaaaagcatagggggttct
tagtctttcttcaaattttgataggtagtagtctaccatgttaaaagcatatttttttctagctaggacaaacatagagaacgtaacctgtacagataca
tatactatcagtgcaaaagcttataaattaatggaaggggttttctcGTG
BAS0340 --- BAS0341
Gene: BAS0340 GI: 49183368 BI number: BAS0340 GOG: ------- Description: conserved hypothetical protein
Gene: BAS0341 GI: 49183369 BI number: BAS0341 GOG: ------- Description: conserved hypothetical protei
t
a a
g t
a c tt
a a c a
a a t g
ta t t ag
ta gc t t
tg gt gc
gc g t at
ta g t ta
| t gc gc
ta at gc
tg | t | a
tg t c at
tg a a tg
tg c a at
tg g a gt
at at ta
gt at ta
gc at ta
gt at ta
gcatatttttttctagctaggacaaacatagagaacgtaacctgtacagatacatatactatcagtgcaaaagcttataaattaatggaaggggttttctcGTG
..................................................................................................................