                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-20.90 kcal/mol

                                                                        Nomenclature/Definitions

ATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTTGAGTGGAATAAT
GGTGATTGCACTTGGGATTGTCCTTGTCACGGTTCCCGCTTTTCAATTGAGGGAGACG
TTATTGAGGGTCCAGCAGATCAACCGTTAAAGCGAGTTGATAATGAGTAAacaaataaagaag
ttcaacagagttcctgttgaacttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatat
attcatctataaataaaaaggGTG

    BAS0349 Gene: BAS0349     GI: 49183377     BI number: BAS0349     GOG: COG0477     Description: benzoate transport protein, putativ            t          g  t          a  c           gc           at           cg           at           at           cg           ta           ta           gc           at           at           gc           at           at           at           ta             tttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatatattcatctataaataaaaaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol Antiterminator: Size=79 nt.     Delta G=-11.43 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G= -8.66 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTTGAGTGGAATAAT GGTGATTGCACTTGGGATTGTCCTTGTCACGGTTCCCGCTTTTCAATTGAGGGAGACG TTATTGAGGGTCCAGCAGATCAACCGTTAAAGCGAGTTGATAATGAGTAAacaaataaagaag ttcaacagagttcctgttgaacttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatat attcatctataaataaaaaggGTG     BAS0349 Gene: BAS0349     GI: 49183377     BI number: BAS0349     GOG: COG0477     Description: benzoate transport protein, putativ            aa           a  g            ta            aa            ag           |  t            at            cc            aa            Aa            Ac            Ta           G  g           A  a           G  |           T  |            Ag AA        At T  A      |  t TG       | GC       | CG       | |  A      | CG       | AT       | AT       | CG       | TA       | AT       | G  A      | A  A      | C  |      | G  |       T AT        A CG       G |  A      T   C  G       T         t T  T       G       g  t G  A       A       a  c G  A       G        gc G  a       C        at A  c      G         cg G  a      A         at Ta       A         at Ta       A         cg At        T        ta Ta        T        ta Ta        G        gc                         ttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatatattcatctataaataaaaaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................