Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-20.90 kcal/mol

                                                                        Nomenclature/Definitions

ATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTTGAGTGGAATAAT
GGTGATTGCACTTGGGATTGTCCTTGTCACGGTTCCCGCTTTTCAATTGAGGGAGACG
TTATTGAGGGTCCAGCAGATCAACCGTTAAAGCGAGTTGATAATGAGTAAacaaataaagaag
ttcaacagagttcctgttgaacttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatat
attcatctataaataaaaaggGTG

    BAS0349


Gene: BAS0349     GI: 49183377     BI number: BAS0349     GOG: COG0477     Description: benzoate transport protein, putativ


           t
         g  t
         a  c
          gc
          at
          cg
          at
          at
          cg
          ta
          ta
          gc
          at
          at
          gc
          at
          at
          at
          ta
            tttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatatattcatctataaataaaaaggGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-11.43 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -8.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTTGAGTGGAATAAT
GGTGATTGCACTTGGGATTGTCCTTGTCACGGTTCCCGCTTTTCAATTGAGGGAGACG
TTATTGAGGGTCCAGCAGATCAACCGTTAAAGCGAGTTGATAATGAGTAAacaaataaagaag
ttcaacagagttcctgttgaacttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatat
attcatctataaataaaaaggGTG

    BAS0349


Gene: BAS0349     GI: 49183377     BI number: BAS0349     GOG: COG0477     Description: benzoate transport protein, putativ


           aa
          a  g
           ta
           aa
           ag
          |  t
           at
           cc
           aa
           Aa
           Ac
           Ta
          G  g
          A  a
          G  |
          T  |
           Ag
 AA        At
T  A      |  t
 TG       |
 GC       |
 CG       |
|  A      |
 CG       |
 AT       |
 AT       |
 CG       |
 TA       |
 AT       |
G  A      |
A  A      |
C  |      |
G  |       T
 AT        A
 CG       G
|  A      T  
C  G       T         t
T  T       G       g  t
G  A       A       a  c
G  A       G        gc
G  a       C        at
A  c      G         cg
G  a      A         at
 Ta       A         at
 Ta       A         cg
 At        T        ta
 Ta        T        ta
 Ta        G        gc
                        ttctttatttgttataaaaccttttcagataaatttcgacaggaaggaggaaaatattaacatgaaataaaataatatattcatctataaataaaaaggGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................