Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCATACATCCCAATCTTCACAAGCTCAGTCAGTATCAATACAGGACATTACAAATAT
GTCTCTTCAAATGCAAAAACTTGTTGACGAATTAGAAAAGTCCGCAACTCAATTTAAA
ATTAAAAACTTGTAAgtatatgaaagaccagctaatttagttggtctttctattttaattacacattcagatttacttatataataact
gtcctccaaaaaaataaaggattctgacaatttatgactaataacagaaataaggggcaacatttgtaaaatatatttttgactgggggttttgtATG


    BAS0354


Gene: BAS0354     GI: 49183382     BI number: BAS0354     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protei


           AT
          A  T
          A  A
          A  A
           TA
           TA
           TA
          |  C
           AT
           AT
           CG
          |  T
          |  A
           TA
           Cg
           At
          |  a
          |  t
          |  a
           At
           Cg
          |  a
          G  a
          C  a        t
  A        Cg       a  t
T  G       Ta        at
T  A       Gc        ta
A  A      A  c       cg
A  A      A  a       gt
G  A      A  g       at
 CG       A  |       cg
 AT        Gc        cg
 GC        At        at
T  C       Ta        gc
 TG        Ta        at
 GC        At        at
 TA        At        at
 TA        Gt        gc
                        tattttaattacacattcagatttacttatataataactgtcctccaaaaaaataaaggattctgacaatttatgactaataacagaaataaggggcaacatttgtaaaatatatttttgactgggggttttgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here

    ..................................................................................................................