                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCATACATCCCAATCTTCACAAGCTCAGTCAGTATCAATACAGGACATTACAAATAT
GTCTCTTCAAATGCAAAAACTTGTTGACGAATTAGAAAAGTCCGCAACTCAATTTAAA
ATTAAAAACTTGTAAgtatatgaaagaccagctaatttagttggtctttctattttaattacacattcagatttacttatataataact
gtcctccaaaaaaataaaggattctgacaatttatgactaataacagaaataaggggcaacatttgtaaaatatatttttgactgggggttttgtATG

    BAS0354 Gene: BAS0354     GI: 49183382     BI number: BAS0354     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protei            AT           A  T           A  A           A  A            TA            TA            TA           |  C            AT            AT            CG           |  T           |  A            TA            Cg            At           |  a           |  t           |  a            At            Cg           |  a           G  a           C  a        t   A        Cg       a  t T  G       Ta        at T  A       Gc        ta A  A      A  c       cg A  A      A  a       gt G  A      A  g       at CG       A  |       cg AT        Gc        cg GC        At        at T  C       Ta        gc TG        Ta        at GC        At        at TA        At        at TA        Gt        gc                         tattttaattacacattcagatttacttatataataactgtcctccaaaaaaataaaggattctgacaatttatgactaataacagaaataaggggcaacatttgtaaaatatatttttgactgggggttttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here     ..................................................................................................................