                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:127 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-21.00 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=42 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:    Distance from promoter:73 nt.    Size=39 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtta-tagact. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttattttagtagaataagagtagactttgaagtagatgaataataagcacatgggagtttgtggatgcaaactgagagtatgactattccgtcattg
accatttgaacctgttggataatgccagcgtagggagagtgtaaaagcacatgttcaggcactttgcgtacgcgcaaagtgcctttttgtgtatctccca
tcactatagttaggagatgagaaggATG

    BAS0362 --- BAS0363 Gene: BAS0362     GI: 49183390     BI number: BAS0362     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: BAS0363     GI: 49183391     BI number: BAS0363     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylas            ca           a  t aa        cg t  t       gt a  g       at gc       a  c gc       a  a ta       a  g tg        tg gc        gc        ac |  g       ta       t  g |  t       gc        gc ta        at        cg cg        gt        gc cg       a  |       ta a  g      g  |       ta a  a      g  |       ta g  |      g  |       cg tg        at        at ta        tg        cg tg        gc        gc at        cg        gc cg        gt        at                         ttttgtgtatctcccatcactatagttaggagatgagaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here     ..................................................................................................................