                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:29 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=77 nt.     Delta G=-23.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tataca-taaaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatacatgcttttgtttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtgagcaaacatcg
accctcaacctgatctggataatgccagcgtagggagttacttaaagtaatgtagcatatgttattctataataacttgcatacaaggctttcctacgtg
gtaggaaagccttttcttgttttaaaatttaatttcataagggggattttattATG

    BAS0366 --- BAS0367 --- BAS0368 --- BAS0369 Gene: BAS0366     GI: 49183394     BI number: BAS0366     GOG: COG0011     Description: conserved hypothetical protein Gene: BAS0367     GI: 49183395     BI number: BAS0367     GOG: COG0600     Description: ABC transporter, permease protein, putative Gene: BAS0368     GI: 49183396     BI number: BAS0368     GOG: COG0715     Description: ABC transporter, substrate-binding protein, putative Gene: BAS0369     GI: 49183397     BI number: BAS0369     GOG: COG1116     Description: ABC transporter, ATP-binding protei ta c  t ta ta at ta ta gc t  t a  | t  | at cg gc |  a at ta gc ta a  a a  g tg gc at a  | a  | t  | t  | c  | a  | t  |        t t  |      g  g g  |       cg at        at gt        ta gc        cg gc        cg at        ta ta        ta gc        ta cg        cg g  |       gc at        gc cg        at cg        at             ttcttgttttaaaatttaatttcataagggggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................