Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:160 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:124 nt. Size=40 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=38 nt.     Delta G= -4.92 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: aagtct-tataat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtcttttaacagtttttggtataattactgttaaaaggcttttttatataggaaaagaaggaacaaaaggaaaagtagagaatagaatataacagagg
agtttatactcttaatataacaaatgttaaaggagtgaaaggataaaatgactttatcaactgttcttcaaatggttttagcttgatatgggagaagtct
gcccatttttatatgcacaattaaataaggctttatactgttgctctctctatttagcttatgaactataagtaaaggagagaaaataATG

    BAS0370


Gene: BAS0370     GI: 49183398     BI number: BAS0370     GOG: COG0488     Description: ABC transporter, ATP-binding protei


           aa
  g       c  a
t  a      t  t
a  c       tg
 at        cg
 at       |  t
 at       t  t
 ta       t  t
 at        gt
 gc        ta
|  a       cg
g  a      |  c       ag
a  c       at       a  t
a  t       at        gc
a  g       cg        at
g  t       ta       |  g
t  t       at        gc
 gc        ta        gc
 at       t  t       gc
 gt        tg        ta
 gc        cg        at
                        ttttatatgcacaattaaataaggctttatactgttgctctctctatttagcttatgaactataagtaaaggagagaaaataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here

    ..................................................................................................................