                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:160 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:124 nt. Size=40 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=38 nt.     Delta G= -4.92 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: aagtct-tataat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtcttttaacagtttttggtataattactgttaaaaggcttttttatataggaaaagaaggaacaaaaggaaaagtagagaatagaatataacagagg
agtttatactcttaatataacaaatgttaaaggagtgaaaggataaaatgactttatcaactgttcttcaaatggttttagcttgatatgggagaagtct
gcccatttttatatgcacaattaaataaggctttatactgttgctctctctatttagcttatgaactataagtaaaggagagaaaataATG

    BAS0370 Gene: BAS0370     GI: 49183398     BI number: BAS0370     GOG: COG0488     Description: ABC transporter, ATP-binding protei            aa   g       c  a t  a      t  t a  c       tg at        cg at       |  t at       t  t ta       t  t at        gt gc        ta |  a       cg g  a      |  c       ag a  c       at       a  t a  t       at        gc a  g       cg        at g  t       ta       |  g t  t       at        gc gc        ta        gc at       t  t       gc gt        tg        ta gc        cg        at                         ttttatatgcacaattaaataaggctttatactgttgctctctctatttagcttatgaactataagtaaaggagagaaaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................