                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:183 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.20 kcal/mol
Antiterminator:    Distance from promoter:165 nt. Size=31 nt.     Delta G= -8.51 kcal/mol
Anti-antiterminator:    Distance from promoter:167 nt.    Size=12 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgata-tataac. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaacgcc is shown in italic-bold style

atgatattcaacaaatttatttcgttataacgatgaaaaaggactagtacatgttcaacctttttagcagagagagaatccgtcaggctgaaagattctt
aaaaagacaacatggaacctacctttgcgttctgcatatgcagcgggaatttcccgttatcaaaaagagagcatgcgcaatttttgtgcatgaatcagggtggtaacgccggcaaagctcggtccctattttgggacgcgggcttttttgtattttctagaaggaggaagactgactATG

    BAS0382 Gene: BAS0382     GI: 49183410     BI number: BAS0382     GOG: COG0442     Description: prolyl-tRNA synthetas             a           a  a            cg            gc           |  t       tt            gc       a  t            cg       t  t            cg        cg            gt        cg           c  |       cg           a  |       ta           a  |       gc           t  |      |  g           g  |       gc ta       g  |       cg g  a      t  |       tg gc        gc        cg tg        gc        gc gc        gc        at gc        at        at                         ttttgtattttctagaaggaggaagactgactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0442 Prolyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................