Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:86 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=66 nt.     Delta G=-18.80 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=40 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-CATAAT. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTTTGTGAATTATACCGTCATAATGGACAGTGGAAGTTTAATGCAGTAGGAAG
CGGATTCCAAGGTGGTTTAGGTGCGCTTGTAAGAGCGTATGGCTTGGATGCATAAgaag
ggaaacgatattcgtttcctttttttgacctttctataaatctagcaaagaataggggatataggtaagATG

    BAS0388


Gene: BAS0388     GI: 49183416     BI number: BAS0388     GOG: COG0861     Description: tellurium resistance protein, putativ


           TA
          G  A
           TG
           TA
           CG
           GC
           CG
           GT
          |  A
          |  T
          |  G
           TG
           GC
           GT
 AG        AT
T  G       TG
G  A       TG
A  A       TA
 CG        GT
 GC       |  G
 TG        GC
A  G       TA
A  A       GT
T  |      |  A
T  |      |  A        a
T  |      G  g      t  t
G  |      A  a      a  t
 AT       A  a       gc
 AT        Cg        cg
 GC        Cg        at
 GC        Tg        at
 TA        Ta        at
G  A      A  a       gc
A  G      G  a       gc
 CG        Gc        gt
 AT        Cg        at
                        tttttgacctttctataaatctagcaaagaataggggatataggtaagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here

    ..................................................................................................................