                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.00 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=20 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TTCATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTAAGTCATACATTGTTCTTCATTATTTTAGTTGTAGCATTTGGAGCAACATT
TATACTTCACTACGTGAAGAATTCTGGACAAGCTAAAGAAGAAGTTGCAGCTACTAAA
AATAACCATAAATAAttgaaatgggtttgctcgttttacgagcgcccattttttataactaaaaatagtttataatggaagaaggactt
agaaaaaacgtaaatgtttttggaggtgaactgttGTG

    BAS0389 --- BAS0390 Gene: BAS0389     GI: 49183417     BI number: BAS0389     GOG: NOG12025     Description: conserved hypothetical protein Gene: BAS0390     GI: 49183418     BI number: BAS0390     GOG: COG3853     Description: tellurite resistance protein, putativ             t           t  t           t  a            gc            cg            ta            cg tt        gc t  g      t  | gc       t  | gt        tg gc        gc tg        gc at        gc at        ta at        at gt        at             ttttataactaaaaatagtttataatggaagaaggacttagaaaaaacgtaaatgtttttggaggtgaactgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3853 Uncharacterized protein involved in tellurite resistance ... can be seen here     ..................................................................................................................