                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTATGAACCACTTTGGATTTGGTTTACATATGTAGCGGCTCAAATGTGTATTGTATA
TGTGGGATTATAAaaagatgctctcaaaaatggtggatagactattttgagagtatcttttttactattttgcttcagctaaattttactg
tctataaatagtgaggtaaatataaaaataaggattttatgaggatgttattttaaattttttaatattcgaattgtataattcaggattttatagaaat
tgagcagttgaagtctttataataaaagtaaaaagatgatgagatggtggaATG

    BAS0400 --- BAS0401 Gene: BAS0400     GI: 49183428     BI number: BAS0400     GOG: -------     Description: type I signal peptidase, N-terminus Gene: BAS0401     GI: 49183429     BI number: BAS0401     GOG: -------     Description: type I singal peptidase, C-terminu            aa AT       A  a A  G      A  g AT        Ta CG        At T  T       Tg C  A      T  c GT        At        at GT        Gc       g  a CG        Gt       g  g G  |       Gc        ta AT        Ta        gc TA       G  a       gt GT       T  a       ta TA       A  a      a  | AT       T  |       at TG       A  |       at AT        Ta        at CG        Gt        at A  |       Tg        cg TG        Tg        ta TG        At        cg TA        Tg        ta GT       G  g       cg GT        Ta        gt TA        Gt        ta                         tcttttttactattttgcttcagctaaattttactgtctataaatagtgaggtaaatataaaaataaggattttatgaggatgttattttaaattttttaatattcgaattgtataattcaggattttatagaaattgagcagttgaagtctttataataaaagtaaaaagatgatgagatggtggaATG     ..................................................................................................................