Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:202 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol
Antiterminator:    Distance from promoter:145 nt. Size=68 nt.     Delta G= -5.25 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgata-tattat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgataatgatagcatgttaatatattatatattgaatacgtttagggggatgtattatgcatttatttgaagtagatagagagtgtacttataaaagtg
tagattacaaagttatttctgtattagacaacgatctattattagttgtacctaaagaagatttagcaaatgaaaaattcccgttacaaacttacgttat
tccagaacaaattgaataaacttattatccaaaagggcttttacatcaaagctctttttatttggttaaaaataatgaggtgatacaTTG

    BAS0457 --- BAS0458


Gene: BAS0457     GI: 49183485     BI number: BAS0457     GOG: NOG08887     Description: phage minor structural protein
Gene: BAS0458     GI: 49183486     BI number: BAS0458     GOG: -------     Description: conserved domain protei


  c
a  a
a  a
g  a
a  t
c  t
 cg
 ta
 ta
 at
 ta
 ta
|  a
g  c
c  t
a  t
t  a
t  t
c  t
a  a
a  t
a  c
c  c       ca
a  a      a  t
t  a      t  c
t  a       ta
g  a       ta
 cg        ta
 cg        cg
 cg        gc
t  c       gt
t  t       gc
 at        at
 at        at
 at        at
            ttatttggttaaaaataatgaggtgatacaTTG


    ..................................................................................................................