Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:127 nt.    Distance to gene:97 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-14.60 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=41 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:    Distance from promoter:99 nt.    Size=18 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgagc-tatctt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgagctgtataaagtatatcatatcttttagtgtaacttatgtcactgttgtgcattctattgcaaagaaaaaacaatatcgtttattttcggtacatt
gaatgtatttaatttatttttagtgtgtggtcatctttgtggtcagtggtcaaatgagagtgagcattttatatgccactctcttcttatttgcatttct
attaaatcgtttgattaaagtaatacaaaatctcacttttaaaatattgtattaattggtatgatttacttaacttaagggggcgattttATG

    BAS0461


Gene: BAS0461     GI: 49183489     BI number: BAS0461     GOG: -------     Description: hypothetical protei


            g
          a  t
          c  g
           tg
           gt
           gc
           ta
          |  a        t
          g  a      t  a
          t  t      t  t
           tg        ta
           ta        at
           cg        cg
 tt        ta        gc
c  t      |  g      a  |
 tg        at        gc
 at        cg        ta
 cg        ta        gc
t  g      g  g       at
g  t       gc        gc
 gc        ta        at
 ta        gt        gc
                        ttcttatttgcatttctattaaatcgtttgattaaagtaatacaaaatctcacttttaaaatattgtattaattggtatgatttacttaacttaagggggcgattttATG


    ..................................................................................................................