Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTATCCATTCGTACCGCTGCTTGCATTAGTATTAAATGTAACAGTAATTGTTGGTATG
GCCTTTATTCCAGAACAAAGAATGGCGTTATATTGTGGAATTCCATTTATGATTGTTT
GCTTACTGTTTTACCGTGCGACAAGAAATAAGGCACATAAAGTAGAACATATTGAAAA
GACAGATACAACAGAAGTAGACAGTTTATAAtattgagtaatttagagactgtaaaattgtaaacagtctctttttt
tgtgaaaataaagctggaaacatattatgtatgtaaagggggattagcgATG

    BAS0467


Gene: BAS0467     GI: 49183495     BI number: BAS0467     GOG: COG0624     Description: acetylornitine deacetylase, putativ



  a
g  g
t  t
t  a       tt
a  a      a  g
t  t      a  t
 At       a  a
 At       a  a
 Ta        ta
A  g       gc
 Ta        ta
 Tg        cg
 Ta        at
 Gc        gc
 At        at
 Cg        gc
 At        at
            ttttttgtgaaaataaagctggaaacatattatgtatgtaaagggggattagcgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here

    ..................................................................................................................