Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=61 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:    Distance from promoter:69 nt.    Size=19 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAT-TAAAAA. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAATTGCTTGAATGGATTTAGTAAAAACGGAAGTGTGTATGTCGTTTTATTATCTA
ACATTCAAAATAATATTAAATCGTTTGGTAAAGTGAACAACGACATTTATACGATGTT
GCGAAATATTGAAGTGTAAgagactatccttttggatagtcttttttttgcttagaccatattgtttcgatgaaaaatgtatgtct
tacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG

    BAS0474 --- BAS0475 --- BAS0476 --- BAS0477


Gene: BAS0474     GI: 49183502     BI number: BAS0474     GOG: -------     Description: hypothetical protein
Gene: BAS0475     GI: 49183503     BI number: BAS0475     GOG: -------     Description: conserved hypothetical protein
Gene: BAS0476     GI: 49183504     BI number: BAS0476     GOG: COG0463     Description: glycosyl transferase, group 2 family protein
Gene: BAS0477     GI: 49183505     BI number: BAS0477     GOG: -------     Description: UDP-N-acetyl-D-mannosamine 6-dehydrogenase, N-terminu


           CG
          G  A
           TA
           TA
           GT
           TA
           AT
           GT
           CG
          A  |
          T  |
          A  |
           TA
           TA
           TG
           AT
           CG
           AT
          G  A
          C  A
          A  g
          A  a
          C  g
          A  |
  T       A  |       tt
A  A      G  |      t  t
T  C       Ta        cg
 TG        Gc        cg
 TA        At        ta
 AT       A  a       at
 CG       A  t       ta
 AT       T  |       cg
 GT        Gc        at
 CG        Gc        gc
                        ttttttttgcttagaccatattgtttcgatgaaaaatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.70 kcal/mol
Antiterminator:    Distance from promoter:70 nt. Size=61 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:    Distance from promoter:71 nt.    Size=33 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAT-TAAAAA. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAATTGCTTGAATGGATTTAGTAAAAACGGAAGTGTGTATGTCGTTTTATTATCTA
ACATTCAAAATAATATTAAATCGTTTGGTAAAGTGAACAACGACATTTATACGATGTT
GCGAAATATTGAAGTGTAAgagactatccttttggatagtcttttttttgcttagaccatattgtttcgatgaaaaatgtatgtct
tacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG

    BAS0474 --- BAS0475 --- BAS0476 --- BAS0477


Gene: BAS0474     GI: 49183502     BI number: BAS0474     GOG: -------     Description: hypothetical protein
Gene: BAS0475     GI: 49183503     BI number: BAS0475     GOG: -------     Description: conserved hypothetical protein
Gene: BAS0476     GI: 49183504     BI number: BAS0476     GOG: COG0463     Description: glycosyl transferase, group 2 family protein
Gene: BAS0477     GI: 49183505     BI number: BAS0477     GOG: -------     Description: UDP-N-acetyl-D-mannosamine 6-dehydrogenase, N-terminu


           TA
          G  A
           Tg
           Ga
           Ag
           Aa
           Gc
           Tt
           Ta
          A  |
          T  |
          A  |
           At
           Ac
           Gc
           Ct
 CG        Gt
G  A       Tt
 TA       T  t
 TA       G  
 GT       T  
 TA       A         tt
 AT       G        t  t
 GT       C  |       cg
 CG       A  |       cg
A  |      T  |       ta
T  |       A        at
A  |       T        ta
 TA        T        cg
 TA       T         at
 TG       A         gc
 AT       C  |       at
 CG        A        gt
 AT        G        At
                        tttttgcttagaccatattgtttcgatgaaaaatgtatgtcttacctatcacaaaaagagtctgctttgtgtacattaagatgtatggatatatttttataatttaaaaataataggaggagaagtgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here

    ..................................................................................................................