                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:121 nt.    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTG-CAAAAT. It has a score value of 64.93 and is shown in blue

TTGCTGAATTAACAATGCTTGCACAAAATGATGTAACACTTCCTGAAGATGCACAAGC
ACAATTTGAAAAAATGGTTGATGCATTAGAAGATTTAGAAGATGTGCAACAAGTTTAC
CACAACGTAGACTTAGGAGAATAAtactgatagaagcccctgttcgtttaatgaataggggcttttttaatgaaggtaatta
aggcaatgaatttaataaaggtattttgttgtaaacagggaatatgcttatagggatatATG

    BAS0511 Gene: BAS0511     GI: 49183537     BI number: BAS0511     GOG: COG0494     Description: mutT/nudix family protei            t          t  a           ta           gt           cg           ta           ta           gt           ta           cg           cg           cg           cg           gc           at             tttttaatgaaggtaattaaggcaatgaatttaataaaggtattttgttgtaaacagggaatatgcttatagggatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................