                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=72 nt.     Delta G=-11.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGCTATATCAATCATGATGAGTATATGCAAGCAGTTAGTGAGAAATTAGTCATTCG
TCATGATATAAAAACAGAGCGGTCGATGTTAAATCATGCGCGCGAAAAAGCAGTGAGC
TAAgggaagttcctacataggagcttctttttttgaataaattgtgacaaattgtgacacaatatcgtcacaattgttgtatttttgtaatttatgtg
agcgtgttcattgcgtgacgtatgtaagtattgatattatgtgtattgtgtacaatgctgtatatagaatatgaatttaaagaggaATG

    BAS0513 Gene: BAS0513     GI: 49183539     BI number: BAS0513     GOG: COG1651     Description: conserved hypothetical protei CG G  G AT GC A  G C  A A  T A  G A  | AT AT TA A  A TA AT GC TA AT CG |  C |  G |  C TG GC CG TA |  A |  A |  A |  A                 ca |  G                a  t |  C       gg        ta |  A      A  g       cg TG       A  a       cg AT        Ta        ta CG        Cg        tg TA        Gt        gc |  G       At        at GC        Gc        at AT       T  |       gc TA        Gc        gt TA        At        gt                         tttttgaataaattgtgacaaattgtgacacaatatcgtcacaattgttgtatttttgtaatttatgtgagcgtgttcattgcgtgacgtatgtaagtattgatattatgtgtattgtgtacaatgctgtatatagaatatgaatttaaagaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1651 Protein-disulfide isomerase ... can be seen here     ..................................................................................................................