                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:129 nt.    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=44 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=52 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAG-TATATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAGATGAGAATTTCAGATATTATATTTTAAAGCAAAAAGCAGATGTATTCCATGC
GATGAAGAGCTTCTTTAGAGAAGAATCAGGAGAGAAAATGGCATAGcccccttaaaaaggggttat
ttttttgttaactttttatttttttagttgacaatgataatgaaaatcattatcatttattcgagatatgattacatttagatttatatattttggagga
gatgtaaagttgaaaaaaataaaagaaaacatataaatgcgATG

    BAS0520 Gene: BAS0520     GI: 49183546     BI number: BAS0520     GOG: COG4886     Description: internalin, putativ aa t  a t  a c  a cg        tt cg       a  t cg       t  t cg       t  t Gt       t  t At       t  t Ta        ta At        cg C  t       at G  t       at G  |       tg T  |       ta At        gc         a At        ta       a  a At        ta       a  t At       t  t       gc G  g      t  |       ta At       t  |       at Gt        tg        at A  a       ta        ta G  a       at        at Gc        ta        gc At        ta        ta                         tttattcgagatatgattacatttagatttatatattttggaggagatgtaaagttgaaaaaaataaaagaaaacatataaatgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4886 Leucine-rich repeat (LRR) protein ... can be seen here     ..................................................................................................................