                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATGTATATAAATATGATAATGGTGATGGAACATACGAATTATCAGTAAAATAAgtactt
ttccaatgtatgtttaactttactttttgtggaaaatagtatattatatagatatataatatatcggttattttctaggaggagcctgtcacaataggct
tctcctgttcttttttaaaggcctgtactgcaggcttttctttaaaggggaaataactgaaaattaagaacaataatctttgaaagaggtggggcataca
cataacaaaaaagggattgtttaagagagggggataagaaATG

    BAS0524 --- BAS0525 Gene: BAS0524     GI: 49183550     BI number: BAS0524     GOG: NOG47428     Description: conserved hypothetical protein Gene: BAS0525     GI: 49183551     BI number: BAS0525     GOG: COG2268     Description: SPFH domain/band 7 family protei            ga           a  t            ta            at            ta            at            ta            ta ac        at a  t       ta t  t       at t  t       ta ta        gt gc       |  c t  t      |  g a  t      |  g t  t      |  t g  t       at        ac t  t       ta       c  a a  g       at        ta at        at        gt cg        at        ta cg        at        cg ta        gc        cg ta        gt        gc ta        ta        at |  a      g  g       gt |  t       tg        gc ta        ta        at cg        tg        gc at        tg        gc ta        ta        at gt        cg        tg                         ttcttttttaaaggcctgtactgcaggcttttctttaaaggggaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacacataacaaaaaagggattgtttaagagagggggataagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2268 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................