Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=76 nt.     Delta G= -9.81 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAAAATTAATGATGATCCGAAAAAATAACGGTGAGCTTGAAAAGGTTGCAGTCGGC
ATCAGTGGAAATATAAGATTAGTAAATGTAGTTGTTGGGCAGCAAATTCATACAGATA
CATTATTAGTTAGGTTGGAAGATGATTTATTAATTACAGGTTGTGAATAAtgagagatgtgta
gatatgactacacatcttttttgttctatatattgcaaaagacacattgttttttcacaaatcgcacacaagtttttgatatgctccttgtagaagatag
ggttagggaggaaataatacaATG

    BAS0532


Gene: BAS0532     GI: 49183558     BI number: BAS0532     GOG: -------     Description: lipoprotein, putativ


            T
          T  T
          A  A
          G  T
          T  T
          A  A
          G  A
          A  T
          A  T
          G  A
           GC
           TA
           TG
          G  G
           GT
  C        AT
G  A       TG
A  A      T  T
C  A      G  G
 GT       A  |
 GT        TA
 GC        TA
 TA        AT
|  T       TA
 TA        TA
 GC        At        at
 TA        Cg       t  g
 TG       |  a      a  a
G  A      A  g       gc
 AT       T  a       at
 TA       A  g       ta
 GC       G  a       gc
 TA        At        ta
A  |       Cg        gc
 AT        At        ta
 AT        Tg        at
 TA        At        gc
 GT       |  a       at
 AT        Cg        gt
 TA        Ta        at
                        tttgttctatatattgcaaaagacacattgttttttcacaaatcgcacacaagtttttgatatgctccttgtagaagatagggttagggaggaaataatacaATG


    ..................................................................................................................