                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-22.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAAATGGGGAGTCAGGCGATTAGTTATGTGAAAAGATCCAAATGAactagtaaggaaagaaat
gtaaggaattgtaagcggattttttgtaggcgtttttttgtacagaaataagagaacttgagcttattctataagctcaagttctcttattttttatgat
taaatctttagaaggagtgaatatgtaaaaatgcataattgacaaaaatattacatgttatcattatatattgttttatatatgtcacttgtataaaatt
acacaagtattcacattacataaaggaggcttattATG

    BAS0544 Gene: BAS0544     GI: 49183570     BI number: BAS0544     GOG: COG0840     Description: methyl-accepting chemotaxis protei   a a  g t  c g  g tg ta at at gt gt        ag at       c  a at       a  a |  g       ta |  t       gt |  a       ta         c |  g       ta       t  t tg        tg        ta gc        ta        at tg        tg        ta at        ta        ta at        ta        cg at        gc        gc gt       |  t       at at       |  t       gc at       |  g       ta at       |  a       ta g  g       cg        cg g  |       gc        at a  |       gt        at at        at        gc ta        ta        at gc        gt        gc                         ttattttttatgattaaatctttagaaggagtgaatatgtaaaaatgcataattgacaaaaatattacatgttatcattatatattgttttatatatgtcacttgtataaaattacacaagtattcacattacataaaggaggcttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................