                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:157 nt.    Distance to gene:16 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=34 nt.     Delta G= -3.14 kcal/mol
Anti-antiterminator:    Distance from promoter:91 nt.    Size=49 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-TAGTAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTAAAAAATCAACTGATGATACGTTAGTATGTTGAAATAGCCACTGAATCATAGG
GCCAGATAATCCCCATAAGGTAGCTCCTGTAATAATCATAATGAGTCCAATTCGTCTA
CTGTTGTTCATgatcatgcatctcctctcgagtatttgattttttgtgtgtgacatgataaaaggaattatatataacttctggtactgtaa
aaagtatcagattttagttttattaaggggtcagatattATG

    BAS0551 Gene: BAS0551     GI: 49183577     BI number: BAS0551     GOG: COG1167     Description: transcriptional regulator, GntR famil ta g  t at gt cg ta c  t t  t c  t       aa        aa c  t      t  a      t  a t  t      a  a      g  a c  t      g  g       ta tg       t  g       cg at       a  a       at cg       c  a       ta gt        at        gt tg        gt        gc at        ta        ta cg        gt        cg ta        ta        ta a  |       gt       t  t gc        ta       c  t Ta        gt        at At        ta        at Cg        ta        ta                         gttttattaaggggtcagatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KE] COG1167 Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs ... can be seen here     ..................................................................................................................