                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=40 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:    Distance from promoter:21 nt.    Size=43 nt.     Delta G= -7.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tgtgct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacg
aataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaaATG

    BAS0691 --- BAS0692 --- BAS0693 --- BAS0694 --- BAS0695 --- BAS0696 --- BAS0697 --- BAS0698 --- BAS0699 --- BAS0700 Gene: BAS0691     GI: 49183715     BI number: BAS0691     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BAS0692     GI: 49183716     BI number: BAS0692     GOG: COG1116     Description: ABC transporter, ATP-binding protein Gene: BAS0693     GI: 49183717     BI number: BAS0693     GOG: COG0600     Description: ABC transporter, permease protein, putative Gene: BAS0694     GI: 49183718     BI number: BAS0694     GOG: COG0715     Description: ABC transporter, substrate-binding protein, putative Gene: BAS0695     GI: 49183719     BI number: BAS0695     GOG: COG0352     Description: regulatory protein TenI Gene: BAS0696     GI: 49183720     BI number: BAS0696     GOG: COG0665     Description: glycine oxidase Gene: BAS0697     GI: 49183721     BI number: BAS0697     GOG: COG2104     Description: conserved hypothetical protein Gene: BAS0698     GI: 49183722     BI number: BAS0698     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BAS0699     GI: 49183723     BI number: BAS0699     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: BAS0700     GI: 49183724     BI number: BAS0700     GOG: COG0351     Description: phosphomethylpyrimidine kinas aa t  t g  a        t gc       a  a at       t  a ta       t  t cg        at t  c       at a  g       at g  a       ta         a ta        at       t  t cg        at       a  a cg        gt        ta a  g       cg        ta c  a      a  c       cg a  a       at        ta a  g       cg        ta t  t       at        cg a  |      |  a       at t  |      a  a       cg t  |       gc        cg cg        gc        at cg        ta        at                         ttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.50 kcal/mol Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttattacctgatctagattatgctagcgtagggaagcaattcggacactaataatgagtccccgtttctttgcgtatagaaacggggcttttttatttg aaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaa gtggaacaacgaataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaa ATG     BAS0691 --- BAS0692 --- BAS0693 --- BAS0694 --- BAS0695 --- BAS0696 --- BAS0697 --- BAS0698 --- BAS0699 --- BAS0700 Gene: BAS0691     GI: 49183715     BI number: BAS0691     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BAS0692     GI: 49183716     BI number: BAS0692     GOG: COG1116     Description: ABC transporter, ATP-binding protein Gene: BAS0693     GI: 49183717     BI number: BAS0693     GOG: COG0600     Description: ABC transporter, permease protein, putative Gene: BAS0694     GI: 49183718     BI number: BAS0694     GOG: COG0715     Description: ABC transporter, substrate-binding protein, putative Gene: BAS0695     GI: 49183719     BI number: BAS0695     GOG: COG0352     Description: regulatory protein TenI Gene: BAS0696     GI: 49183720     BI number: BAS0696     GOG: COG0665     Description: glycine oxidase Gene: BAS0697     GI: 49183721     BI number: BAS0697     GOG: COG2104     Description: conserved hypothetical protein Gene: BAS0698     GI: 49183722     BI number: BAS0698     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BAS0699     GI: 49183723     BI number: BAS0699     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: BAS0700     GI: 49183724     BI number: BAS0700     GOG: COG0351     Description: phosphomethylpyrimidine kinas   t a  a a  a t  t c  g a  a cg at        cg gc       g  t gc       t  a c  c      t  t t  c       ta t  |       cg a  |       ta a  |       ta cg        ta gt        gc at        cg at        cg gc        cg gt        cg gt       t  | at        gc tg        at gc        gt             ttttatttgaaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacgaataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................