                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgccgaagtaagttgtgtccaccatgcacacttgctgggtctgcatttaataagtgcagaactgtcacaaacgtttcgtttgtggagagctatcgagagg
tatgtcgtgggtttcttataagatagaaagcatgtagcggcaaattacgtgctttttttgttttgtttggaacttctcttcctgactcaggaagacatac
atatctcctcgcttgacttggttatactaactttggaggtattttctatgcaacaaaaaaatggggcttttgggtactaacagctttcgttgtcggtaat
ATG

    BAS0805 Gene: BAS0805     GI: 49183829     BI number: BAS0805     GOG: COG0531     Description: amino acid permease family protei            aa           t  g           a  a           t  t            ta         c gt        cg       g  a g  a      |  a      g  a a  t       ta       c  a g  g       ta        gt at        tg        at gc        gc        ta cg       |  a       gc t  |      |  t       tg at       |  g       at tg       g  t       cg cg       g  a       gc g  g       tg        at at        gc        at gt        cg        at at        tg        gt gc        gc        at                         ttgttttgtttggaacttctcttcctgactcaggaagacatacatatctcctcgcttgacttggttatactaactttggaggtattttctatgcaacaaaaaaatggggcttttgggtactaacagctttcgttgtcggtaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.00 kcal/mol Antiterminator: Size=38 nt.     Delta G= -6.60 kcal/mol Anti-antiterminator:   Size=17 nt.     Delta G= -3.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgccgaagtaagttgtgtccaccatgcacacttgctgggtctgcatttaataagtgcagaactgtcacaaacgtttcgtttgtggagagctatcgagagg tatgtcgtgggtttcttataagatagaaagcatgtagcggcaaattacgtgctttttttgttttgtttggaacttctcttcctgactcaggaagacatac atatctcctcgcttgacttggttatactaactttggaggtattttctatgcaacaaaaaaatggggcttttgggtactaacagctttcgttgtcggtaat ATG     BAS0805 Gene: BAS0805     GI: 49183829     BI number: BAS0805     GOG: COG0531     Description: amino acid permease family protei            tg           g  g           c  g           t  t            gt            tt           |  c        c            at       g  a            tt       g  a            ga       c  a            gt        gt           |  a       at ag       |  a       ta g  a      |  g       gc cg       a  a       tg tg       g  t       at at        aa        cg ta        gg        gc |  t       ca        at cg        ta        at gt        aa        at                         ttttgttttgtttggaacttctcttcctgactcaggaagacatacatatctcctcgcttgacttggttatactaactttggaggtattttctatgcaacaaaaaaatggggcttttgggtactaacagctttcgttgtcggtaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................