                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-21.40 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=47 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ctgata-tacaat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctgatatgaaatatggttcaattacaattgttgtacaagatggaaaagtcattcaactagagaaaagtgaaaaagtacgtttaaagtaaaaagcgctgac
tagaaaaactagaggcggttttaacctatttcattaggttaaaaccgtctttttgcttttacagggggaaaaaacATG

    BAS1330 --- BAS1331 --- BAS1332 --- BAS1333 --- BAS1334 Gene: BAS1330     GI: 49184347     BI number: BAS1330     GOG: COG0175,COG5270     Description: phosphoadenosine phosphosulfate reductase Gene: BAS1331     GI: 49184348     BI number: BAS1331     GOG: COG2046     Description: sulfate adenylyltransferase Gene: BAS1332     GI: 49184349     BI number: BAS1332     GOG: COG0529     Description: adenylylsulfate kinase Gene: BAS1333     GI: 49184350     BI number: BAS1333     GOG: COG0155     Description: nitrite reductase Gene: BAS1334     GI: 49184351     BI number: BAS1334     GOG: -------     Description: hypothetical protei   t t  a t  a g  a cg at         a ta       a  a g  a      a  a a  a       gc        tc a  a       at       t  a a  a       ta       t  t a  g       cg        at a  |      a  a       ta gc       g  |       cg tg        tg        cg gc        cg        at at        gc        at a  g       cg        ta a  a      g  g       ta a  |       at        ta g  |       at        ta a  |       at        gc gc        at        gc at       a  a       cg ta        ta        gt cg        gc        gc                         tttttgcttttacagggggaaaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here [J] COG5270 PUA domain (predicted RNA-binding domain) ... can be seen here [P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here [P] COG0529 Adenylylsulfate kinase and related kinases ... can be seen here [P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................