                                                                        Gene putatively regulated by attenuation in B_anthracis_str_Sterne

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-11.14 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=48 nt.     Delta G=-10.12 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=55 nt.     Delta G= -8.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tatatt. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaggaaaagttgccgaagtttatatttcttctctggaaatatgagctggggctgtgtctgaaaggaacagaactgtcacgtttacaaaattaccgt
gtaaacgtggggtgctatcttaacggaagggtatgatggggtggttatttgtgaaacgttccgccaaattcctttggcggttttttgtatttttctcccc
cgctccttcctatcttacaagaaaaggagtgttgaacATG

    BAS2862 --- BAS2863 --- BAS2864 Gene: BAS2862     GI: 49185868     BI number: BAS2862     GOG: COG0833     Description: lysine-specific permease Gene: BAS2863     GI: 49185869     BI number: BAS2863     GOG: -------     Description: conserved hypothetical protein Gene: BAS2864     GI: 49185870     BI number: BAS2864     GOG: COG4335     Description: conserved hypothetical protei ct g  a t  t gc         t gt       t  g g  t      t  t g  a      a  g ta       t  a gc       t  a cg       g  a |  g       gc |  a       tg        tc |  a      g  t      t  c |  g      g  t       at |  g       gc        at |  g       gc        at |  t      t  |       cg a  a      a  |       cg a  t      g  |       gc a  g      t  |       cg ta       a  |       cg gt        tg       t  t tg        gc       t  t g  g       gc       g  t cg       |  a      c  t cg       |  a      a  t at       g  a      a  t tg        at       a  g tg        at        gt at        gc        ta at        gc        gt                         ttttctcccccgctccttcctatcttacaagaaaaggagtgttgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0833 Amino acid transporters ... can be seen here [L] COG4335 DNA alkylation repair enzyme ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_str_Sterne This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=48 nt.     Delta G=-10.12 kcal/mol Anti-antiterminator:    Distance from promoter:83 nt.    Size=32 nt.     Delta G= -7.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-tatatt. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaaaggaaaagttgccgaagtttatatttcttctctggaaatatgagctggggctgtgtctgaaaggaacagaactgtcacgtttacaaaattaccgt gtaaacgtggggtgctatcttaacggaagggtatgatggggtggttatttgtgaaacgttccgccaaattcctttggcggttttttgtatttttctcccc cgctccttcctatcttacaagaaaaggagtgttgaacATG     BAS2862 --- BAS2863 --- BAS2864 Gene: BAS2862     GI: 49185868     BI number: BAS2862     GOG: COG0833     Description: lysine-specific permease Gene: BAS2863     GI: 49185869     BI number: BAS2863     GOG: -------     Description: conserved hypothetical protein Gene: BAS2864     GI: 49185870     BI number: BAS2864     GOG: COG4335     Description: conserved hypothetical protei             t           a  t           t  t           t  g           g  t           g  g           t  a            ga            ga           g  c           g  g            tt gg        at a  g      g  | a  t      t  | g  a      a  | gt       t  | cg       g  | a  a       gc        tc at        gc       t  c tg        ag        at tg       |  c       at cg       |  c       at tg       a  a       cg at        ga        cg tg        ga        gc cg        ct        cg gt        at        cg                         ttttttgtatttttctcccccgctccttcctatcttacaagaaaaggagtgttgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0833 Amino acid transporters ... can be seen here [L] COG4335 DNA alkylation repair enzyme ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................