                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAATTTGGTGGACGTGATCATACAACAGTTATCCATGCCCATGAAAAAATCTCTAA
ACTACTAAAAACCGATACGCAATTACAAAAGCAAGTTGAAGAAATTAATGGTATTTTA
AAGTAGtagctgaatagtgtgaataacttaccttgttttacgcacagtctatccacatgtagatagactgtttttacatcctttagcggggttatc
cacatatccacaagccctattactattactactattttttatctttattaattaaataaaatcttatacttaccggaggtttttctttATG

    BC0002 Gene: BC0002     GI: 30018280     BI number: BC0002     GOG: COG0592     Description: DNA polymerase III, beta chai   T G  A G  T T  T AT AT TA TA         c A  A      a  c A  G      t  t A  T      t  t G  A       cg A  G       at A  |      a  | Gt       t  | Ta        at Tg        at Gc        gt        at At        ta       c  g A  g       gc       a  t C  a       tg       c  a G  a       gc        cg A  t      a  a       ta A  a      t  |       at A  g      a  |       ta At       a  |       cg Cg        gc        ta At        ta        gc Tg        cg        at Ta        gt        cg                         tttttacatcctttagcggggttatccacatatccacaagccctattactattactactattttttatctttattaattaaataaaatcttatacttaccggaggtttttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0592 DNA polymerase sliding clamp subunit (PCNA homolog) ... can be seen here     ..................................................................................................................