                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGAGAAGAGTTAAAAATTTCTTTTAGTGCAAAATATATGATGGATGCATTGAAAGC
TTTGGATAGTACAGAGATTAAAGTTAGCTTTACTGGGGCGATGAGACCGTTCTTAATT
CGTACAGTAAATGATGATTCAATTATTCAATTAATTTTACCGGTTCGTACTTACTAGg
taaggaataagggttgctagtttaaagatgctagtggcccttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatg
aacactttcagaaagtgagcgattttATG

    BC0003 --- BC0004 --- BC0005 Gene: BC0003     GI: 30018281     BI number: BC0003     GOG: COG2501     Description: hypothetical protein Gene: BC0004     GI: 30018282     BI number: BC0004     GOG: COG1195     Description: DNA replication and repair protein recF Gene: BC0005     GI: 30018283     BI number: BC0005     GOG: COG0187     Description: DNA gyrase subunit CA T  A T  T AT TA TA AT AT |  T |  T        C |  A      A  T |  C      T  A |  C       TG CG        Cg        aa TG        At       a  g T  T       Ta       t  a AT       |  a      t  t GC       G  g       tg TG        Cg        gc AT        Ta        at G  A       Ta        ta T  C       Gt        cg A  |      |  a      g  t AT       |  a      t  g AT       G  g       tg TA        Cg        gc GC        Cg        gc AT        At        gc                         ttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatgaacactttcagaaagtgagcgattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2501 Uncharacterized conserved protein ... can be seen here [L] COG1195 Recombinational DNA repair ATPase (RecF pathway) ... can be seen here [L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here     ..................................................................................................................