                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:140 nt.    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:119 nt. Size=39 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGGCT-GATATT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGCTTACGTGCAGGTATGGGATATTGCGGAGCACAGGATTTAGAATTCTTACGCGA
AAATGCACAATTCATTCGTATGTCAGGTGCTGGCTTACGTGAAAGTCATCCTCATCAC
GTACAAATTACAAAAGAGGCTCCAAACTACTCATTATAAtgtcttatatacaaatagacagagatttgata
tctctgtctatttttttttgattatgttagaataacggttatgtgagtacatagatattgggggtagcaaaaGTG

    BC0014 Gene: BC0014     GI: 30018287     BI number: BC0014     GOG: COG1686     Description: D-alanyl-D-alanine carboxypeptidas   a t  c a  a t  a        g a  a      t  a t  t      t  t ta        ta cg        at ta        gc gc        at ta        gc A  g       at A  a       cg T  g       at A  a       gc T  t       at T  t       ta At        at Cg        at Ta        at             ttttttgattatgttagaataacggttatgtgagtacatagatattgggggtagcaaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1686 D-alanyl-D-alanine carboxypeptidase ... can be seen here     ..................................................................................................................