                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=56 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAACCGGTAAGTCACTGCAAGTGGATCTTGTAACGACATCTGAAGTAGAAGAAGCAAA
CTGGTTTACTCGTGCTATGCGCGGAATTGGTTCATTCTTTAGTGGTATGTGGAATAGT
GCTGTTGATACAGTAAAAGGTTGGTTTTAAaagctcctcacgataggagcttttttttattcctatttttcataccga
ctttatgaaaaagtagtagacaagcatctgatagttagtggtagaatgtaagagtattcttaattttcgcctttaacgggggaaagcaattcacctaggg
gggtttTTG

    BC0015 --- BC0016 Gene: BC0015     GI: 30018288     BI number: BC0015     GOG: COG0214     Description: pyridoxine biosynthesis protein Gene: BC0016     GI: 30018289     BI number: BC0016     GOG: COG0311     Description: pyridoxine biosynthesis amidotransferas            GA           T  T            TA            GC            TA            CG            GT            TA           |  A           |  A           |  A           |  G           |  G           |  T           G  T   G       A  G T  G       TG G  A       AT TA        AT        cg AT        GT       a  a TA        GT       c  t G  G       TA        ta GT       G  A       cg TG       T  a       cg GC       A  a       ta AT        Tg        cg TG        Gc        gc T  T      G  t       at T  T      T  c       at CG        Gc        At TA        At        At                         ttttattcctatttttcataccgactttatgaaaaagtagtagacaagcatctgatagttagtggtagaatgtaagagtattcttaattttcgcctttaacgggggaaagcaattcacctaggggggtttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0214 Pyridoxine biosynthesis enzyme ... can be seen here [H] COG0311 Predicted glutamine amidotransferase involved in pyridoxine biosynthesis ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.20 kcal/mol Antiterminator: Size=56 nt.     Delta G= -8.90 kcal/mol Anti-antiterminator:   Size=43 nt.     Delta G= -7.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAACCGGTAAGTCACTGCAAGTGGATCTTGTAACGACATCTGAAGTAGAAGAAGCAAA CTGGTTTACTCGTGCTATGCGCGGAATTGGTTCATTCTTTAGTGGTATGTGGAATAGT GCTGTTGATACAGTAAAAGGTTGGTTTTAAaagctcctcacgataggagcttttttttattcctatttttcataccga ctttatgaaaaagtagtagacaagcatctgatagttagtggtagaatgtaagagtattcttaattttcgcctttaacgggggaaagcaattcacctaggg gggtttTTG     BC0015 --- BC0016 Gene: BC0015     GI: 30018288     BI number: BC0015     GOG: COG0214     Description: pyridoxine biosynthesis protein Gene: BC0016     GI: 30018289     BI number: BC0016     GOG: COG0311     Description: pyridoxine biosynthesis amidotransferas            AA           A  G            AG            TT            GT            AG            CG            AT   A       |  T T  G      |  T T  T      |  T TG       |  A CG       |  A |  T      |  a |  A      T  a T  T      A  g TG        Gc AT        Tt CG        Tc        cg TG        Gc       a  a TA        Tt       c  t G  A       Cc        ta GT       G  a       cg TA       T  c       cg TG       G  g       ta AT        A        cg A  G       T        gc GC       A         at GT       A         at CG        G        At GT        G        At                         ttttattcctatttttcataccgactttatgaaaaagtagtagacaagcatctgatagttagtggtagaatgtaagagtattcttaattttcgcctttaacgggggaaagcaattcacctaggggggtttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0214 Pyridoxine biosynthesis enzyme ... can be seen here [H] COG0311 Predicted glutamine amidotransferase involved in pyridoxine biosynthesis ... can be seen here     ..................................................................................................................