                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

gtaaattgatggtaacaattttataaaataagcgtgttgataggaaatagtaacaaatgtcgtttcttatagagagtcgatggttggtggaaatcgatag
aaacagtttgtgaatccatcctggaatggaatgtggaatatcttttggattagtaagcattcccggtgaagagccgttatttctacttgagaggaaagcg
gtaatgctttcaactagggtggcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtataca
ATG

    BC0017 Gene: BC0017     GI: 30018290     BI number: BC0017     GOG: COG0172     Description: Seryl-tRNA synthetas ta g  a       aa gt       t  c cg       t  t gc        gc        at at        gc       t  a at        gc       t  t at        cg        ta gc        gt        cg g  a      c  |       cg a  a      a  |       cg gc       a  |       ta at       c  |       gc g  a      g  |       cg t  g      g  |       cg tg       t  |       cg cg        gc        ta at        gc        cg tg        gc        at cg        at        at                         ttttgtgttttataaaataaaaggaggagtatacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol Antiterminator: Size=31 nt.     Delta G=-10.71 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G=-15.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggcaacgcg is shown in italic-bold style gtaaattgatggtaacaattttataaaataagcgtgttgataggaaatagtaacaaatgtcgtttcttatagagagtcgatggttggtggaaatcgatag aaacagtttgtgaatccatcctggaatggaatgtggaatatcttttggattagtaagcattcccggtgaagagccgttatttctacttgagaggaaagcg gtaatgctttcaactagggtggcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtataca ATG     BC0017 Gene: BC0017     GI: 30018290     BI number: BC0017     GOG: COG0172     Description: Seryl-tRNA synthetas   t t  g c  a a  g ta cg tg ta ta a  | ta tg gc cg cg        gt gt       g  g |  a      g  g |  a       ac        at |  t       ta       t  a a  g       ca       t  t gc        ac        ta at        ag        cg at       c  |       cg gt       t  |       cg |  c      t  |       ta |  a      t  |       gc ta       c  |       cg gc       g  |       cg gt       t  |       cg |  a       ac        ta cg        ag        cg cg        tg        at cg        gg        at                         ttttgtgttttataaaataaaaggaggagtatacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................