                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtaagtggtgttgacgtttgggtcctgcgcaacgggaccccgtgaaccttgtcaggtccggaaggaagcagcaataagcgggtcttctcgtgtgccgc
aggagtgcctgaaccgagctaactgcttgagtaacgcttatggtacgtaatcgacggagggtgcacggcagttatatatgtatacaaaactcaccttaat
acaaaggtgagttttttgtatagaaaataacttttggaatctataaacagaatgggttataataaatgagataataacctttgagggaggccgtattttc
GTG

    BC0024 --- BC0025 --- BC0026 --- BC0027 Gene: BC0024     GI: 30018295     BI number: BC0024     GOG: COG2812     Description: DNA polymerase III subunit gamma/tau Gene: BC0025     GI: 30018296     BI number: BC0025     GOG: COG0718     Description: hypothetical Transcriptional Regulatory Protein Gene: BC0026     GI: 30018297     BI number: BC0026     GOG: COG0353     Description: Recombination protein recR Gene: BC0027     GI: 30018298     BI number: BC0027     GOG: NOG17258     Description: hypothetical Cytosolic Protei at t  a t  t g  a at cg gt |  a |  t       ta g  a      a  c c  c      a  a a  a       ta c  a       ta g  a       cg ta        cg gc        at gt        cg gc        ta a  a       cg gc        at gc        at             ttttgtatagaaaataacttttggaatctataaacagaatgggttataataaatgagataataacctttgagggaggccgtattttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2812 DNA polymerase III, gamma/tau subunits ... can be seen here [S] COG0718 Uncharacterized protein conserved in bacteria ... can be seen here [L] COG0353 Recombinational DNA repair protein (RecF pathway) ... can be seen here     ..................................................................................................................