                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -5.39 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAACAAACTTAAAACCTGTAAAATTACGCGGTGAATTATCGCAAGGTATGATTTTAGC
GGGTGAAGAGAATGGCGTATTGTCATTAGCATCAATTGACCAAAATCTACCAAATGGT
ACAAAAATCAAGTAAttaagacaagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttatactctctattttt
gcattaagattgtagtattgttatcgttaagttattaaagaacttatttttgtagaataaacttgatttcaatataaaaggagttatgtattatgTTG

    BC0044 Gene: BC0044     GI: 30018310     BI number: BC0044     GOG: COG0084     Description: Sec-independent secretion protein tat            AA           A  T            CG            CG            AT            TA           C  C           T  A           A  A           A  A           A  A           A  A           C  |           C  |            AT            GC            TA            TA           |  G           |  T   A       |  A T  T      |  A G  T      |  t CG       |  t GT       |  a GC       |  a TA       |  g AT       |  a        a AT       |  c      a  c G  A      |  a       ta A  G      |  a       gt G  |      |  g      t  g A  |      |  a      g  t A  |      |  a       cg GC       |  a       at TA       |  a       cg GT       A  g       ta GC       A  a       ta G  A       Cg        tg C  A       Ta        gc GT        At        tg AT        Cg        at TG        Gt        gc TA        At        at                         tttttctttttatactctctatttttgcattaagattgtagtattgttatcgttaagttattaaagaacttatttttgtagaataaacttgatttcaatataaaaggagttatgtattatgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:42 nt.    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-13.40 kcal/mol Antiterminator:    Distance from promoter:11 nt. Size=68 nt.     Delta G= -5.39 kcal/mol Anti-antiterminator:   Size=63 nt.     Delta G= -7.54 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGTCA-CAAAAT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGTCATTAGCATCAATTGACCAAAATCTACCAAATGGTACAAAAATCAAGTAAttaaga caagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttatactctctatttttgcattaagattgtagtattgttatcgttaagt tattaaagaacttatttttgtagaataaacttgatttcaatataaaaggagttatgtattatgTTG     BC0044 Gene: BC0044     GI: 30018310     BI number: BC0044     GOG: COG0084     Description: Sec-independent secretion protein tat            ga           a  a            aa            ca            ag            ga           a  g           a  a           t  t           t  g AA       A  t A  T      A  t CG       T  | CG       G  | AT        At TA        Ac C  C       Ca T  A       Tc A  A      |  g A  A      |  t A  A      |  g A  A      |  t C  |      |  a C  |      |  a AT       |  c GC       |  a TA       | TA       |          a A  G      |        a  c A  T      |         ta C  A      |         gt T  A      |        t  g A  |      |        g  t C  |      |         cg Gt       |         at At       |         cg Ta       A         ta Ta       A         ta A  |       A        tg Cg        A        gc Ta        A        tg Gc        C        at Ta        A        gc Ta        T        at                         tttttctttttatactctctatttttgcattaagattgtagtattgttatcgttaagttattaaagaacttatttttgtagaataaacttgatttcaatataaaaggagttatgtattatgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................