                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=79 nt.     Delta G= -7.47 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTAGCAGAAGAAATTGCGAATTTAAAAGGGATTTCTTATGAGGAAGTAGCAGAAAT
GACAACTAAAAATGCAAAAGTTTTATTTGGTGTTGAATAAaaaagaatggggaaacctgttcttttttat
tttgagaaaaactagtagaagtgatgaagaaaataaatgtgaatgatgaagtgttacaataaggacagagaacaaagatttttctattctattttttaaa
atataagaatggggaaaataataatggaaaagtcgtcatttttttgttttactaagtagagacgaaatgagtGTG

    BC0045 --- BC0046 Gene: BC0045     GI: 30018311     BI number: BC0045     GOG: COG1658     Description: Ribonuclease M5 Gene: BC0046     GI: 30018312     BI number: BC0046     GOG: COG0030     Description: Dimethyladenosine transferas             T           A  G           A  C           A  A           A  A           A  A            TA            CG            AT            AT           C  |            AT            GT            TA            AT            AT            AT           |  G           G  G            AT            CG            GT GG        AT A  A       TG G  A      |  A TG       |  A AT       |  T TA       |  A |  G      G  A |  C      A  a       aa TA       A  a      g  a CG       G  a       gc TA       G  a       gc TA       A  g       gt TA       G  a       tg GT        Ta        at TG        At        at |  A       Tg        gc |  C       Tg        at G  A       Cg        at tA        Tg        at gC        Ta        at aT        Ta        At                         tattttgagaaaaactagtagaagtgatgaagaaaataaatgtgaatgatgaagtgttacaataaggacagagaacaaagatttttctattctattttttaaaatataagaatggggaaaataataatggaaaagtcgtcatttttttgttttactaagtagagacgaaatgagtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1658 Small primase-like proteins (Toprim domain) ... can be seen here [J] COG0030 Dimethyladenosine transferase (rRNA methylation) ... can be seen here     ..................................................................................................................