                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.64 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCGCACAGCGCCGTAAAACTTTGATGAATAATTTATCAAATAATTTAAATGGTTTC
CCGAAAGATAAGGAATTATTGGATCGAATTTTAACAGAAGTAGGAATTGATCCAAAGC
GAAGAGGCGAAACGCTATCTATTGAAGAGTTTGCAACATTAAGTAATGCATTAGTTCT
TCATAAATTATCATAAgaatatgaaagggacagttcaagttgaactgtcccttttgtcacctttctctctttaaattcatactttaaa
aacaggtaagatggcctaatgagtttggaggtaggagaATG

    BC0047 Gene: BC0047     GI: 30018313     BI number: BC0047     GOG: NOG05029     Description: Sporulation-specific protease Yab   T T  A A  A CG        CA AT       T  T |  A      A  A |  A      T  A AT       T  g CG       A  a GC       A  a        g TA        At       a  t |  T       Ta       a  t |  T       At        cg T  A       Cg        ta T  G       Ta        ta GT       |  a       gc AT       |  a       at GC        Tg        cg AT        Cg        at AT        Tg        gc GC        Ta        gc TA        Gc        gc                         ttttgtcacctttctctctttaaattcatactttaaaaacaggtaagatggcctaatgagtttggaggtaggagaATG     ..................................................................................................................