                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTGGCAAAAGTGAAGAAAAATATGCCGAAGTGGGCTACGATTCCGATTGTAGGAATG
CAAGCGCAGTAAaatgtaagtggaatgtttatctataatttgattttaaaaacctaggtgaatacctaggtttttttgtgggaaaaggtaa
tgttattaattttgtgaatagacacggaggatgtaagataaaaatgtaatttttgtatatcttttttttgcacaatgtttgtaaaagttgtaccattgta
gacaaggtgactaaggttgctgttcttgtttaatgaaaggtgattgcgaagTTG

    BC0070 --- BC0071 Gene: BC0070     GI: 30018334     BI number: BC0070     GOG: COG0037     Description: Cell cycle protein MesJ Gene: BC0071     GI: 30018335     BI number: BC0071     GOG: COG0634     Description: Hypoxanthine-guanine phosphoribosyltransferas AA T  a G  a At Cg Gt |  a |  a Cg Gt |  g       tt |  g      t  t |  a      a  a A  a      g  a At        ta Cg        ta Gt        ta T  t      a  c       aa A  t      a  c      g  t A  a      t  |       ta Gt        at        gc Gc        ta        gc At        cg        at Ta        tg        ta Gt        at        cg Ta        tg        cg Ta        ta        at At        ta        at Gt        gt        at                         ttttgtgggaaaaggtaatgttattaattttgtgaatagacacggaggatgtaagataaaaatgtaatttttgtatatcttttttttgcacaatgtttgtaaaagttgtaccattgtagacaaggtgactaaggttgctgttcttgtttaatgaaaggtgattgcgaagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0037 Predicted ATPase of the PP-loop superfamily implicated in cell cycle control ... can be seen here [F] COG0634 Hypoxanthine-guanine phosphoribosyltransferase ... can be seen here     ..................................................................................................................