                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -3.67 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAAAAAGGTACTTGTTATTATCCCGAGTAACGGTGAACGTTATTTAAGTACACCAC
TTTATCAATTTGAATCCTAAttaaacgcgattgaaaaagcatccttgaaaaagggtgctttttcttttgggattggaaataggaa
aagagtgaatgactagaaaacttcatgtaaaataagaggtagtataattaaattattttcactagccttcgagtataatcaatctctatataaataactt
atgtagtttgagctggtttatctaagagggtgggataaaagaagacggggtgttgatATG

    BC0076 --- BC0077 --- BC0078 --- BC0079 --- BC0080 --- BC0081 --- BC0082 --- BC0083 Gene: BC0076     GI: 30018340     BI number: BC0076     GOG: COG0147     Description: Para-aminobenzoate synthase component I Gene: BC0077     GI: 30018341     BI number: BC0077     GOG: COG0512     Description: Anthranilate synthase component II Gene: BC0078     GI: 30018342     BI number: BC0078     GOG: COG0115     Description: 4-amino-4-deoxychorismate lyase Gene: BC0079     GI: 30018343     BI number: BC0079     GOG: COG0294     Description: Dihydropteroate synthase Gene: BC0080     GI: 30018344     BI number: BC0080     GOG: COG1539     Description: Dihydroneopterin aldolase Gene: BC0081     GI: 30018345     BI number: BC0081     GOG: COG0801     Description: 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase Gene: BC0082     GI: 30018346     BI number: BC0082     GOG: COG1396     Description: Transcriptional regulator, Xre family Gene: BC0083     GI: 30018347     BI number: BC0083     GOG: COG0042     Description: Nif3 family protei AA T  t C  t C  a T  a A  a A  c G  g T  c Tg Ta At At Cg Ta A  a Ta Ta Ta        aa Cg       g  a A  c       ta C  a       ta C  t       cg A  c       cg C  |       tg A  |       at T  |       cg Gc        gc At        at At        at Tg        at Ta        at             tcttttgggattggaaataggaaaagagtgaatgactagaaaacttcatgtaaaataagaggtagtataattaaattattttcactagccttcgagtataatcaatctctatataaataacttatgtagtttgagctggtttatctaagagggtgggataaaagaagacggggtgttgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here [H] COG0294 Dihydropteroate synthase and related enzymes ... can be seen here [H] COG1539 Dihydroneopterin aldolase ... can be seen here [H] COG0801 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase ... can be seen here [K] COG1396 Predicted transcriptional regulators ... can be seen here [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here     ..................................................................................................................