Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=59 nt.     Delta G= -9.02 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTATTTAAAAGGTGTTCGTGGTAATGCGAGTGTACGTAATGGTATTAATGCTTGTA
ACACACGGGAAGACCTTGCGAATGTGTTAGGTACATTTGTAGAAGAAGTGGAAGCGAA
ACAACAAACAATTTACGTTGGTTAAtaatggacataggagattgacattcttctatacacttcctataattacgtgaaagaa
agaagagctgccagttagttgctggcagtttttctagttgagtagaaaatgctatactgtatatattgtaaaattaaatagagctggagtgatatcaata
tcATG

    BC0084


Gene: BC0084     GI: 30018348     BI number: BC0084     GOG: COG1190     Description: Lysyl-tRNA synthetas


            t
          a  a
          t  a
          c  t
          c  t
          t  a
          t  c
           cg
           at
           cg
          |  a
          |  a
  a       |  a
g  c      a  g
t  a      t  a
t  t      a  a
 at        ta
 gc        cg
 at        ta
 gt        ta
 gc        cg         g
 at        ta       a  t
 ta        tg       t  t
 at       |  c       tg
|  a       at        gc
|  c       cg        at
|  a      a  c       cg
|  c       gc        cg
c  t       ta        gc
 at        tg        ta
 gc        at        cg
 gc        gt        gt
                        ttttctagttgagtagaaaatgctatactgtatatattgtaaaattaaatagagctggagtgatatcaatatcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1190 Lysyl-tRNA synthetase (class II) ... can be seen here

    ..................................................................................................................