                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -8.15 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACAGAAGGAGCGATTGCAGCTATTGCTGATAAAGGGTTTGATCGTGAATATGGTGCT
CGTCCACTACGTAGAGCAATTCAGAAGCATGTAGAAGATAGACTATCGGAAGAACTTT
TAAAAGGTGCTATTGAGAAAGGTCAAAAAGTTATCTTTGATGTAGAAGGGGAAACATT
TGTCATTCATAGTGCTGAAAAGGTAAAATAAgtatagacaaactaagagggctacgagatagccctctttcttgtac
gagaaggtcaaatgtttatagatgaaagcgaagtgaaatataaaaagatATG

    BC0103 --- BC0104 Gene: BC0103     GI: 30018353     BI number: BC0103     GOG: COG1066     Description: DNA repair protein RadA Gene: BC0104     GI: 30018354     BI number: BC0104     GOG: COG1623     Description: DNA-binding protei   A A  A G  A TG CG GT TA G  A A  A TA AT C  A TA Tg At |  a |  t |  a Cg Ta Gc Ta Ta Ta A  c C  t A  a A  a A  g G  a        a G  g      g  g G  g      c  a G  g       at A  |       ta A  |       cg Gc        gc At        gc Ta        gc Gc        at Tg        gc             tttcttgtacgagaaggtcaaatgtttatagatgaaagcgaagtgaaatataaaaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1066 Predicted ATP-dependent serine protease ... can be seen here [R] COG1623 Predicted nucleic-acid-binding protein (contains the HHH domain) ... can be seen here     ..................................................................................................................