                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.50 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=70 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGCA-TAGAAC. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCACAGATGATGCAAGTCTTGTAGAACGTGTTGGGAAGCAAGTAGGTGTAGTAGA
GGGGAGTTACTATAATATTAAAGTGACGACTCCGGAAGATCTATTAATTGCTGAAAGT
TTCCTACGTGTTCAAAAGAAATAAcattgatgacgtgttaataaagaaaagctcggcaacagccgggcttttctttataagg
atagcgatataatatagagtcataaagctcagtagtttagcttaaggaggaagtaaggATG

    BC0107 Gene: BC0107     GI: 30018357     BI number: BC0107     GOG: COG0245     Description: 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthas   A A  T A  A G  A A  c A  a At At Cg Ta T  t G  g Ta Gc Cg At Tg |  t |  t |  a |  a |  t |  a |  a C  a Cg Ta Ta Ta        ac G  a      a  a A  g       cg A  c       gc At        gc Gc        cg Tg        tg Cg        cg Gc        gc Ta        at Ta        at             ttctttataaggatagcgatataatatagagtcataaagctcagtagtttagcttaaggaggaagtaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here     ..................................................................................................................