                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-27.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -2.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggaaccgcg is shown in italic-bold style

ccttcgagtcttctgctgaacagcgaattgcttcgtgggatgtcttaggccgcaaagtaagcagaagcggtttacaccgttatcatggatgagtttgagg
cttttttaagcctaaacagagtggaaccgcgcttaaaaggcgtctctgtcaatatgacagagacgccttttttttataccgtgtaaataggtatgactat
agaatttatctccttatataaagaattatgggagaagtgatgagttaggggagttagttcgctcgacaaaaaagcagcccataaaggggagggaacaccg
ATG

    BC0109 --- BC0110 --- BC0111 --- BC0112 --- BC0113 Gene: BC0109     GI: 30018359     BI number: BC0109     GOG: COG1045     Description: Serine acetyltransferase Gene: BC0110     GI: 30018360     BI number: BC0110     GOG: COG0215     Description: Cysteinyl-tRNA synthetase Gene: BC0111     GI: 30018361     BI number: BC0111     GOG: COG1939     Description: hypothetical protein Gene: BC0112     GI: 30018362     BI number: BC0112     GOG: COG0566     Description: 23S rRNA methyltransferase Gene: BC0113     GI: 30018363     BI number: BC0113     GOG: COG3688     Description: hypothetical Cytosolic Protei             a           a  a           t  a        t            tg       a  a            cg       a  t            gc        cg            cg        ta            gt        gc           c  |       ta           c  |       cg           a  |       ta           a  |       cg           g  |       ta aa       g  |       gc g  c      t  |       cg gc        gc        gc tg        at        gc gc        gc        at a  g       at        at gc        cg        at at        at        at                         ttttataccgtgtaaataggtatgactatagaatttatctccttatataaagaattatgggagaagtgatgagttaggggagttagttcgctcgacaaaaaagcagcccataaaggggagggaacaccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1045 Serine acetyltransferase ... can be seen here [J] COG0215 Cysteinyl-tRNA synthetase ... can be seen here [S] COG1939 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0566 rRNA methylases ... can be seen here [R] COG3688 Predicted RNA-binding protein containing a PIN domain ... can be seen here     ..................................................................................................................