                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTAAGCGTGATAAAGTACGCGAAATCGCTGAAACTAAAATGCCTGACCTAAACGCT
GCTAGTGTAGAAGCTGCAATGCGTATGGTTGAAGGTGCTGCACGCAGTATGGGCATCG
TTATCGAAGATTAAttcgatttgtttttaaaaaaggttgcgggtctggaattccaattcgcaacctttattatcgtaaatgattatcgtt
tttaaataaatggatggcgctcatcctcaggttatacctgaaaacaggcgtaaacgtgggaggttattccgctaaaaccacattcgaggaggaaATG

    BC0118 Gene: BC0118     GI: 30018368     BI number: BC0118     GOG: COG0081     Description: LSU ribosomal protein L1            aa           a  a TT       a  a A  A       tg G  A       tg At       t  t       at At       t  t      a  t Gc        tg        gc Cg        gc        gc Ta        tg        ta At        tg       c  | T  t       tg        ta T  |       at        gt G  |       gc        gt C  |      |  t       gc T  |      |  g       cg At        cg        gc Cg        ta        ta Gt        ta        ta Gt        At        gc Gt        At        gc                         tttattatcgtaaatgattatcgtttttaaataaatggatggcgctcatcctcaggttatacctgaaaacaggcgtaaacgtgggaggttattccgctaaaaccacattcgaggaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0081 Ribosomal protein L1 ... can be seen here     ..................................................................................................................