Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:48 nt. Size=75 nt.     Delta G=-11.47 kcal/mol
Anti-antiterminator:    Distance from promoter:37 nt.    Size=28 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tataat. It has a score value of 89.02 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttcataaagaagttttaatataatcatttatgttgtgaatttaattagtgtaccgtagacagtaggtgtcaatagacttaatttcctacccaggt
gttaatatacgaagcggaatcttttttctgtgactatatgcctccatgtctacaagttgggcatggaggtttttagtgcactttcggtacatcttctata
taatctacaggaggtgtaataacATG

    BC0119


Gene: BC0119     GI: 30018369     BI number: BC0119     GOG: COG0244     Description: LSU ribosomal protein L10


           tt
          c  t
          t  t
           at
           at
           gc
           gt
           cg
           gt
          a  g
          a  a
          g  c
          c  |
           at
           ta
           at
           ta
           at
          a  |
          t  |
          t  |
          g  |
           tg
           gc
           gc
           at
          c  c
          c  c
 at       c  a
a  a      a  t
 cg       t  |        a
 ta       c  |      a  g
 gc       c  |      c  t
|  t      t  |       at
|  t      t  |       tg
|  a      t  |       cg
|  a      a  |       tg
|  t      a  |       gc
|  t      t  |       ta
t  t      t  |       at
 gc        cg        cg
 gc        at        cg
 at        gc        ta
 ta        at        cg
 gc        ta        cg
                        tttttagtgcactttcggtacatcttctatataatctacaggaggtgtaataacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0244 Ribosomal protein L10 ... can be seen here

    ..................................................................................................................