Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.60 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=55 nt.     Delta G=-14.54 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=52 nt.     Delta G= -6.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAAA-TAAAAG. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAATCACTGGTCTTGGCTTAAAAGAAGCTAAAGAATTAGTTGACAACACTCCAAA
AGTAATCAAAGAAGCTGCTGCTAAAGAAGAAGCTGAAGAAATCAAAGCTAAACTTGAA
GAAGTTGGCGCTGCTGTAGAAGTTAAGTAAttaacttttgatgctttaaaaaaagctcgctctcatgcgagctttttt
tttaactgtaaagaaaagaggtggccatATG

    BC0121


Gene: BC0121     GI: 30018371     BI number: BC0121     GOG: COG2813     Description: 16S rRNA m(2)G 1207 methyltransferas


           TA
          G  A
           At
           At
           Ta
           Ta
           Gc
 AA        At
G  G       At
 TA        Gt
 TA        At
 CG        Tg
A  |      |  a
 AT       |  t
 AT       |  g
 TG       |  c
 CG       |  t
 GC       |  t
A  G      |  t
A  C      |  a
 AT       |  a
 CG       |  a       tc
T  C      |  a      c  a
A  T      |  a      t  t
A  G      G  a       cg
A  T       Ta        gc
G  A       Cg        cg
A  G       Gc        ta
A  A      T  t       cg
G  |      C  |       gc
 TA        Gc        at
 CG        Cg        at
 GT        Gc        at
 AT        Gt        at
                        tttttaactgtaaagaaaagaggtggccatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG2813 16S RNA G1207 methylase RsmC ... can be seen here

    ..................................................................................................................